Sequence ID | >SRA1023828 |
Genome ID | SRR035084.185956 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 237 |
End posion on genome | 166 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tacagactaa |
tRNA gene sequence |
GCTTCTATCGTCTAGTGGTTAAGACTTCGAGCTGTTAACTCGAGTACCGTGGTTCAATTC |
Downstream region at tRNA end position |
ttagaatgag |
Secondary structure (Cloverleaf model) | >SRA1023828 Asn GTT a Gttt ttagaatgag G - C C - G T - A T - A C - G T - A A - T T T T G C A C C A T G A C | | | | | A G T C T G C G T G G C G | | | | T T T A G A C T A T GTAC T - A C - G G - C A - T G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |