Sequence ID | >SRA1023903 |
Genome ID | SRR035084.204903 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 288 |
End posion on genome | 205 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gatactataT |
tRNA gene sequence |
ACAAGGATGCCCGAGTGGTCTAAGGGGGTGGTTTCAAGCACCACTATCTTCGGATGCGCG |
Downstream region at tRNA end position |
atgtcctcgt |
Secondary structure (Cloverleaf model) | >SRA1023903 Leu CAA T ATat atgtcctcgt A - T C - G A - T A - T G - C G - C A - T T A T C G C C C A T G A G | | | | | A G G C C C G C G G G C G | | | T T T A G G G C T A G TATCTTCGGATGC G - C T - A G - C G - C T - A T C T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |