Sequence ID | >SRA1023909 |
Genome ID | SRR035084.205535 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 169 |
End posion on genome | 96 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcttgttgtt |
tRNA gene sequence |
CCTCTCTTAGCTCAGTTGGTAGAGCAATGGACTGTAGTTCCATTTGTCACCTGTTCGATT |
Downstream region at tRNA end position |
tttttctccc |
Secondary structure (Cloverleaf model) | >SRA1023909 Tyr GTA t ACat tttttctccc C - G C - G T - A C - G T - A C - G T - A T T T T G G A C A T G A A | | | | | G T C T C G A C C T G C G | | | | T T G G A G C T A A TTGTC A - T T - A G - C G - C A - T C T T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |