Sequence ID | >C151068257 |
Genome ID | CP010411 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium longum subsp. infantis BT1 [CP010411] |
Start position on genome | 882607 |
End posion on genome | 882680 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cagcgtacgt |
tRNA gene sequence |
GCGGACGTAGTTCATCGGTAGAATGAAAGCTTCCCAAGCTTTAGAGGCGGGTTCGACTCC |
Downstream region at tRNA end position |
cttgtctcaa |
Secondary structure (Cloverleaf model) | >C151068257 Gly CCC t TCCA cttgtctcaa G - C C - G G - C G - C A - T C - G G - C T C T T G C C C A T A A + | | | | G C C T T G G C G G G C G | | | + T T G G A A T T A G AGAG A - T A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |