Sequence ID | >C151068529 |
Genome ID | CP010423 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pragia fontium 24613 [CP010423] |
Start position on genome | 2119299 |
End posion on genome | 2119223 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tatgatatgt |
tRNA gene sequence |
GCGTCCGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
aattaattaa |
Secondary structure (Cloverleaf model) | >C151068529 Val GAC t ACCA aattaattaa G - C C - G G - C T - A C - G C - G G - C T G T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |