Sequence ID | >SRA1024080 |
Genome ID | SRR035084.244523 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 215 |
End posion on genome | 141 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ggacattttT |
tRNA gene sequence |
TCTCCCATAGCTCAGTTGGTAGAGCGTGCGACTGTTAATCGCAAGGTCATCGGTTCGAAC |
Downstream region at tRNA end position |
gttgttttta |
Secondary structure (Cloverleaf model) | >SRA1024080 Asn GTT T GTta gttgttttta T - A C - G T - A C - G C - G C - G A - T C A T T G G C C A T G A A | + | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G AGGTC T - A G - C C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |