| Sequence ID | >C151070470 |
| Genome ID | CP010525 |
| Phylum/Class | Bacillota |
| Species | Heyndrickxia coagulans HM-08 [CP010525] |
| Start position on genome | 1187349 |
| End posion on genome | 1187440 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
ggagccatat |
| tRNA gene sequence |
GGAGAAGTACTCAAGTGGCTGAAGAGGCGCCCCTGCTAAGGGTGTAGGTCGCGATTAGCG |
| Downstream region at tRNA end position |
tttttggccc |
| Secondary structure (Cloverleaf model) | >C151070470 Ser GCT
t GCCA tttttggccc
G - C
G - C
A - T
G - C
A - T
A - T
G - C T A
T C T C C C A
T G A A | | | | | A
G A C T C G A G G G C
G | | | T T
C A G A G
T G A G TAGGTCGCGATTAGCGGCGC
C - G
G + T
C - G
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |