| Sequence ID | >SRA1024281 |
| Genome ID | SRR035084.291626 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 11 |
| End posion on genome | 85 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
ttttatatgt |
| tRNA gene sequence |
TCCTCTGTAGCTCAATTGGCAGAGCGCCTGACTGTTAATCAGGTCGTTGTAGGTTCGATT |
| Downstream region at tRNA end position |
gtttaacgtc |
| Secondary structure (Cloverleaf model) | >SRA1024281 Asn GTT
t CCAa gtttaacgtc
T + G
C A
C - G
T + G
C - G
T + G
G - C T T
T C A T C C A
T A A A | | | | | G
T C T C G G T A G G C
G | | | | T T
G G A G C
C A G TCGTT
C - G
C - G
T - A
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |