| Sequence ID | >SRA1024336 |
| Genome ID | SRR035084.301828 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 318 |
| End posion on genome | 402 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
acaagtttgt |
| tRNA gene sequence |
GGGCGAATGGCGGAATTGGTAGACGCGCTGGTCTTAGGAACCAGTATTGAAAGATGTGAA |
| Downstream region at tRNA end position |
taaaagttat |
| Secondary structure (Cloverleaf model) | >SRA1024336 Leu TAG
t ACCA taaaagttat
G + T
G - C
G - C
C - G
G - C
A - T
A - T T G
T T T T C C A
T A A G + | | | | G
T G G C G G A A G G C
G | | | T T
G A C G C
T A G G TATTGAAAGATGT
C - G
T - A
G - C
G - C
T - A
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |