Sequence ID | >C151072935 |
Genome ID | CP010817 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Myroides profundi D25 [CP010817] |
Start position on genome | 643688 |
End posion on genome | 643602 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgccaattga |
tRNA gene sequence |
GCTCGAGTGGTGGAAGTGGTAGACACGCTGGACTTAAAATCCAGTGGGTAGTAATGCCCG |
Downstream region at tRNA end position |
agaatcccaa |
Secondary structure (Cloverleaf model) | >C151072935 Leu TAA a ACag agaatcccaa G + T C - G T - A C - G G - C A - T G - C T G T C G C C C A G A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGGGTAGTAATGCCCGT C - G T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |