| Sequence ID | >SRA1024550 |
| Genome ID | SRR035084.346655 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 264 |
| End posion on genome | 192 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
aacaaatttA |
| tRNA gene sequence |
GCTCTCTTAGTTCAAAGGTAGAATACTTGTCTGATACACAAGTGGTCCAGGTTCGAGTCC |
| Downstream region at tRNA end position |
ctccccccta |
| Secondary structure (Cloverleaf model) | >SRA1024550 Ile GAT
A TTaa ctccccccta
G - C
C - G
T - A
C - G
T - A
C - G
T - A T G
T G G T C C A
A A A | | | | | G
A C T T G C C A G G C
G | | | + T T
G G A A T
T A A TGGT
C - G
T - A
T - A
G - C
T - A
C C
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |