Sequence ID | >SRA1024988 |
Genome ID | SRR035084.454356 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 397 |
End posion on genome | 324 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ctctttattT |
tRNA gene sequence |
CCCGGATTAGCTCAGCGGTANAGCAGTTGACTGTTAATCAATTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
ctttttatcc |
Secondary structure (Cloverleaf model) | >SRA1024988 Asn GTT T GTtc ctttttatcc C A C - G C - G G - C G - C A - T T - A T A T C G A C C A G A A | | | | | G C C T C G G C T G G C G | | | T T G N A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |