Sequence ID | >SRA1025136 |
Genome ID | SRR035084.495115 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 196 |
End posion on genome | 120 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
actcctacta |
tRNA gene sequence |
CCTTCCCTAGCTCAACTGGATAGAGCAACTGACTTCTAATCAGTAGGTTGCAGGTTCGAG |
Downstream region at tRNA end position |
ataactagag |
Secondary structure (Cloverleaf model) | >SRA1025136 Arg TCT a ACCA ataactagag C - G C - G T - A T - A C - G C - G C - G T G T C G T C C A C A A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTT A - T C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |