| Sequence ID | >C151081624 |
| Genome ID | CP011368 |
| Phylum/Class | Mycoplasmatota |
| Species | Mycoplasmopsis canis LV [CP011368] |
| Start position on genome | 406210 |
| End posion on genome | 406285 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
cttccaccat |
| tRNA gene sequence |
GCCGTCTTAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCGTAGGTTCGAGT |
| Downstream region at tRNA end position |
tattgtgtgc |
| Secondary structure (Cloverleaf model) | >C151081624 Thr TGT
t ACCA tattgtgtgc
G - C
C - G
C - G
G - C
T - A
C - G
T - A T G
T T A T C C A
T G A A + | | | | G
T C T C G G T A G G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |