Sequence ID | >SRA1025493 |
Genome ID | SRR035085.24773 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 358 |
End posion on genome | 446 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cctgcaagcT |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGACGAATGGGACGGTCTCGAAAACCGTTGTAGCCTTATGGCTA |
Downstream region at tRNA end position |
gaatgatcta |
Secondary structure (Cloverleaf model) | >SRA1025493 Ser CGA T GTtg gaatgatcta G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G A C C G A G G G C G | | | T T A A T G G C G A G TGTAGCCTTATGGCTACC A - T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |