Sequence ID | >SRA1025604 |
Genome ID | SRR035085.48399 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 126 |
End posion on genome | 37 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaatttaatT |
tRNA gene sequence |
GGAGAGGTGCGAGAGCGGTTGAATCGGTCCGCCTGGAAAGCGGATGTACCCCAAAAGGGT |
Downstream region at tRNA end position |
tattttttgc |
Secondary structure (Cloverleaf model) | >SRA1025604 Ser GGA T GTat tattttttgc G - C G - C A - T G - C A - T G - C G - C T A T G T C C C A C G A G | | | | | G G G A G C C A G G G C G | | | T T T A T C G T G A G TGTACCCCAAAAGGGTACC T - A C - G C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |