| Sequence ID | >C151084308 |
| Genome ID | CP011538 |
| Phylum/Class | Mycoplasmatota |
| Species | Metamycoplasma hominis Sprott [CP011538] |
| Start position on genome | 513132 |
| End posion on genome | 513058 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
tgccagtgtt |
| tRNA gene sequence |
GCCACCATAGCCAAACGGCCAAGGCATAGGTCTGCAACACCTTGATTACCGGTTCGAATC |
| Downstream region at tRNA end position |
atgcgcccgt |
| Secondary structure (Cloverleaf model) | >C151084308 Cys GCA
t TCCA atgcgcccgt
G - C
C - G
C - G
A - T
C - G
C - G
A - T T A
T T G G C C A
C A A A | | | | | G
G A C C G A C C G G C
G | | | T T
C A G G C
C A A GATT
T T
A - T
G - C
G - C
T - A
C C
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |