| Sequence ID | >SRA1025632 |
| Genome ID | SRR035085.53463 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 327 |
| End posion on genome | 402 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
tttttaaccT |
| tRNA gene sequence |
TGGGGTGTCGTCTAATGGCAAGACAGCAGACTCTGGATCTGCCTATTGGGGTTCGAATCC |
| Downstream region at tRNA end position |
Attttctttt |
| Secondary structure (Cloverleaf model) | >SRA1025632 Gln CTG
T AGCC Attttctttt
T C
G - C
G - C
G - C
G - C
T - A
G - C T A
T G T C C C A
A A C + + | | | G
T T C T G T G G G G C
G | | | | T T
G A G A C
C A A CTAT
G - C
C - G
A - T
G - C
A - T
C A
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |