Sequence ID | >SRA1025636 |
Genome ID | SRR035085.54455 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 189 |
End posion on genome | 112 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tgattaaggc |
tRNA gene sequence |
GACCCCATCGTCTAGCCCGGCCTAGGACTCCAGGTTTTCATCCTGGCAACACGGGTTCAA |
Downstream region at tRNA end position |
aaacatcttg |
Secondary structure (Cloverleaf model) | >SRA1025636 Glu TTC c GCCA aaacatcttg G - C A - T C - G C - G C - G C - G A - T T A T T G C C C A C C G A C | | | | | A C T C T G A C G G G C G + | | | T T G G G A C C C T A T CAAC C - G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |