Sequence ID | >SRA1025724 |
Genome ID | SRR035085.71529 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 35 |
End posion on genome | 128 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caattataaa |
tRNA gene sequence |
GGAGAGATGCCGGAGCTGGCTTATCGGGCACGATTGGAAATCGTGTGAGGGGTTTATAGC |
Downstream region at tRNA end position |
tcatcttcaa |
Secondary structure (Cloverleaf model) | >SRA1025724 Ser GGA a GCTA tcatcttcaa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T C G A G | | | | | G G G G C C G A G G G C G + | | | T T C T C G G T T A G TGAGGGGTTTATAGCTTCTCC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |