Sequence ID | >SRA1025823 |
Genome ID | SRR035085.89239 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 201 |
End posion on genome | 127 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tgtctttgag |
tRNA gene sequence |
GGGCCGTTAACTCAGCGGGAGAGTGCTATCCTCACACGGTAGAAGCCACTGGTTCAAATC |
Downstream region at tRNA end position |
ttcttgcttc |
Secondary structure (Cloverleaf model) | >SRA1025823 Val CAC g ACCA ttcttgcttc G - C G - C G - C C - G C - G G - C T - A T A T T G A C C A G A A | | | | | A C C T C A A C T G G C G | | | | T T G G A G T G A G AAGCC C - G T - A A - T T + G C - G C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |