| Sequence ID | >C151087498 |
| Genome ID | CP011926 |
| Phylum/Class | Bdellovibrionota |
| Species | Bdellovibrio bacteriovorus [CP011926] |
| Start position on genome | 2093964 |
| End posion on genome | 2093882 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
ttataggtgc |
| tRNA gene sequence |
GCGCGGATGGTGGAATTGGTAGACACGTACGTTTGAGGGGCGTATGCGCAAGCGTGAGGG |
| Downstream region at tRNA end position |
ctctttgggc |
| Secondary structure (Cloverleaf model) | >C151087498 Leu GAG
c ACCA ctctttgggc
G - C
C - G
G - C
C - G
G - C
G - C
A - T T G
T C T C C C A
T A A G | | | | | A
T G G T G G A G G G C
G | | | T T
G A C A C
T A G G TGCGCAAGCGT
T - A
A - T
C - G
G - C
T + G
T G
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |