| Sequence ID | >SRA1025941 |
| Genome ID | SRR035085.113912 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 28 |
| End posion on genome | 121 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tagtttttac |
| tRNA gene sequence |
GGAGAGATGTCCGAGCGGCTTAAGGAGCACGACTGGAAATCGTGTGTATGCCCTCAAAGG |
| Downstream region at tRNA end position |
tatattatga |
| Secondary structure (Cloverleaf model) | >SRA1025941 Ser GGA
c GCCA tatattatga
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C C C C C A
C G A G | | | | | G
G G C C T G G G G G C
G | | | T T
C A G G A
T T A G TGTATGCCCTCAAAGGTGTACC
C - G
A - T
C - G
G - C
A - T
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |