| Sequence ID | >SRA1025960 |
| Genome ID | SRR035085.117372 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 396 |
| End posion on genome | 311 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
tgttaatagt |
| tRNA gene sequence |
GCGAGAGTGGCGGAATTGGCAGACGCACTGGACTTAGGATCCAGCCCGCAATGCGGATAG |
| Downstream region at tRNA end position |
tttagaatgt |
| Secondary structure (Cloverleaf model) | >SRA1025960 Leu TAG
t ACCA tttagaatgt
G - C
C - G
G - C
A - T
G - C
A - T
G - C T G
T T C C C C A
T A A G | | | | | A
T G G C G A G G G G C
G | | | T T
G A C G C
C A G A CCCGCAATGCGGAT
C - G
T - A
G - C
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |