Sequence ID | >SRA1025965 |
Genome ID | SRR035085.118580 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 196 |
End posion on genome | 270 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tcatacatac |
tRNA gene sequence |
GCGGGTGTAGTTCAGTGGTAGAACGTCAGCTTCCCAAGCTGGATGTCTCGGGTTCGAATC |
Downstream region at tRNA end position |
aacaaagcgc |
Secondary structure (Cloverleaf model) | >SRA1025965 Gly CCC c TCCA aacaaagcgc G - C C - G G - C G - C G - C T - A G - C T A T A G C C C A G A A | | | | | G T C T T G T C G G G C G | | | | T T G G A A C T A G ATGTC T + G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |