Sequence ID | >SRA1026018 |
Genome ID | SRR035085.127429 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 316 |
End posion on genome | 241 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tgaacgtagt |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTAGAGCAGCTGGCTTTTAACCAGCGGGTCGGAGGTTCGAGT |
Downstream region at tRNA end position |
aaaaatcacg |
Secondary structure (Cloverleaf model) | >SRA1026018 Lys TTT t ACCA aaaaatcacg G - C G + T G - C C - G C - G G - C T - A T G T C C T C C A T G A A | | | | | G T C T C G G G A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |