Sequence ID | >SRA1026023 |
Genome ID | SRR035085.128543 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 163 |
End posion on genome | 80 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttacatgaag |
tRNA gene sequence |
GGAGGATTAGTCTAATTGGTAAGGCAGCAGTCTTGAAAACTGCCGGGTTAACACCCTTGG |
Downstream region at tRNA end position |
caaaaacctg |
Secondary structure (Cloverleaf model) | >SRA1026023 Ser TGA g GCac caaaaacctg G - C G - C A - T G - C G - C A - T T - A T G T C T C C C A T A A A | + | | | G T T C T G G G G G G C G | | + | T T G A G G C T A A CGGGTTAACACCCTT G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |