Sequence ID | >SRA1026069 |
Genome ID | SRR035085.135982 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 91 |
End posion on genome | 177 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgacctcact |
tRNA gene sequence |
GCCCGAGTGGTGGAATTGGTATACACAAGGGACTTAAAATCCCTCGAGAGCAATCTCATG |
Downstream region at tRNA end position |
ataaagaaga |
Secondary structure (Cloverleaf model) | >SRA1026069 Leu TAA t ACAA ataaagaaga G - C C - G C - G C - G G - C A - T G - C T G T C G C T C A T A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A T A CGAGAGCAATCTCAT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |