Sequence ID | >SRA1026074 |
Genome ID | SRR035085.137729 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 74 |
End posion on genome | 149 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aatacttact |
tRNA gene sequence |
TGGGGATTAGTTCAGTTGGTAGAACGTCTGATTTTGATTCAGAAGGTCAATGGTTCGAGT |
Downstream region at tRNA end position |
aattgcaggg |
Secondary structure (Cloverleaf model) | >SRA1026074 Gln TTG t TCTA aattgcaggg T - A G - C G - C G - C G - C A - T T - A T G T T T A C C A T G A A | | | | | G T C T T G A A T G G C G | | | | T T G G A A C T A G AGGTC T - A C - G T - A G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |