Sequence ID | >SRA1026297 |
Genome ID | SRR035085.181634 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 338 |
End posion on genome | 412 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aagaagatat |
tRNA gene sequence |
TGCGGGGTGGTGTAATGGTAACACGTCAGACTTTGAATCTGAAGACTCTAGGTTCGATCC |
Downstream region at tRNA end position |
acttgtgcaa |
Secondary structure (Cloverleaf model) | >SRA1026297 Gln TTG t ACAA acttgtgcaa T - A G - C C - G G - C G - C G - C G - C C T T G A T C C A A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C T A G AGACT T - A C - G A - T G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |