Sequence ID | >SRA1026317 |
Genome ID | SRR035085.184943 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 33 |
End posion on genome | 108 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tggcgcacgt |
tRNA gene sequence |
GGGTGATTAACTCAGAGGCTAGAGTGCTTCCCTTACAAGGAAGAAGTCGTAGGTTCGAAT |
Downstream region at tRNA end position |
ttttttatta |
Secondary structure (Cloverleaf model) | >SRA1026317 Val TAC t ACCA ttttttatta G - C G - C G - C T + G G - C A - T T - A T A T C A T C C A A G A A | | | | | G G C T C A G T A G G C G | | | | T T C G A G T T A G AAGTC C - G T - A T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |