| Sequence ID | >SRA1026369 |
| Genome ID | SRR035085.194311 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 164 |
| End posion on genome | 245 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
aaatcagcaa |
| tRNA gene sequence |
GCCCGGTTGGCGAAATTGGCAGACGCGCCAGATTTAGGATCTGGTTCCGCAAGGAGTGTG |
| Downstream region at tRNA end position |
tatttttccg |
| Secondary structure (Cloverleaf model) | >SRA1026369 Leu TAG
a Attt tatttttccg
G - C
C - G
C - G
C - G
G - C
G + T
T - A T G
T C T C C C A
T A A G | | | | A
T A G C G G T G G G C
G | | | T T
G A C G C
C A G G TTCCGCAAGGAGT
C - G
C - G
A - T
G - C
A - T
T A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |