Sequence ID | >SRA1026420 |
Genome ID | SRR035085.203766 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 238 |
End posion on genome | 314 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tattcaacat |
tRNA gene sequence |
GCACCCGTAGCTCAACTGGATAGAGTGCTTGGCTTCGGACCAAGAGGTTGTAGGTTCGAG |
Downstream region at tRNA end position |
gtaagaattt |
Secondary structure (Cloverleaf model) | >SRA1026420 Arg TCG t ACCA gtaagaattt G - C C - G A - T C - G C - G C - G G - C T G T C A T C C A C A A A | | | | | G T C T C G G T A G G C G | | | + T T G G A G T A T A G AGGTT C - G T - A T - A G - C G - C C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |