Sequence ID | >SRA1026706 |
Genome ID | SRR035085.266438 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001806) |
Species | |
Start position on genome | 263 |
End posion on genome | 187 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tcattgttat |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGCTAGAGCACGACAATCGCAATGTCGAGGTCAGGAGTTCAAC |
Downstream region at tRNA end position |
aagttgatta |
Secondary structure (Cloverleaf model) | >SRA1026706 Ala CGC t ACCA aagttgatta G - C G - C G + T C - G C - G T - A G - C T C T T C C T C A T G A A | | | | | A T C T C G A G G A G C G | | | | T T G G A G C C T A A AGGTC C - G G - C A - T C - G A - T A A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |