Sequence ID | >C151095920 |
Genome ID | CP012590 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces sp. oral taxon 414 F0588 [CP012590] |
Start position on genome | 3725922 |
End posion on genome | 3726008 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tcggggcact |
tRNA gene sequence |
GGAGAGGTGACAGAGCGGCCGAATGTGGCGGTCTTGAAAACCGCTGTGCGCTTGGCGCAC |
Downstream region at tRNA end position |
tccgcgcgcc |
Secondary structure (Cloverleaf model) | >C151095920 Ser TGA t GCgg tccgcgcgcc G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | + | | | G G G A C A G G G G G C G | | | T T C A T G T C G A G TGTGCGCTTGGCGCACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |