Sequence ID | >SRA1026977 |
Genome ID | SRR035086.37384 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 428 |
End posion on genome | 354 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttagcaatag |
tRNA gene sequence |
GCCTCCGTGGCGCAATTGGTTAGCGCGTTCGGCTGTTAACCGAAAGGTTGGTGGTTCGAG |
Downstream region at tRNA end position |
aacatttttt |
Secondary structure (Cloverleaf model) | >SRA1026977 Asn GTT g GCtc aacatttttt G - C C - G C - G T + G C - G C - G G - C T G T C C A C C A T A A G | | | | | G T C G C G G G T G G C G | | | | T T G G C G C T T A G AGGTT T - A T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |