| Sequence ID | >SRA1027300 |
| Genome ID | SRR035086.101662 |
| Phylum/Class | 454 Sequencing (SRP001807) |
| Species | |
| Start position on genome | 289 |
| End posion on genome | 359 |
| Amino Acid | Pro |
| Anticodon | AGG |
| Upstream region at tRNA start position |
aatatgaact |
| tRNA gene sequence |
GGCTCTTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGTCCCGGTTCAAATCC |
| Downstream region at tRNA end position |
atatttttta |
| Secondary structure (Cloverleaf model) | >SRA1027300 Pro AGG
t Caaa atatttttta
G - C
G - C
C - G
T - A
C - G
T + G
T - A T A
T G G C C C A
G A G | | | | A
G T C T G C C C G G C
G | | + T T
G T G A T
T A T AGGT
C - G
T - A
C - G
G - C
C - G
T T
T G
A G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |