Sequence ID | >SRA1027337 |
Genome ID | SRR035086.107874 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 97 |
End posion on genome | 173 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccagagcgg |
tRNA gene sequence |
CGCGGGGTAGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCAGGAGTTCAAA |
Downstream region at tRNA end position |
cttcaaaccc |
Secondary structure (Cloverleaf model) | >SRA1027337 Met CAT g ACCA cttcaaaccc C C G - C C - G G - C G - C G - C G - C T A T T C C T C A T G A A | | | | | A C C G A G A G G A G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |