Sequence ID | >SRA1027420 |
Genome ID | SRR035086.121957 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 349 |
End posion on genome | 430 |
Amino Acid | Ser |
Anticodon | AGA |
Upstream region at tRNA start position |
aaatatatgg |
tRNA gene sequence |
GCAGTCGTGGCCGAGTGGTTAAGGCGACTGACTAGAAATCAGTTTCCCTCTGGGAGCGTA |
Downstream region at tRNA end position |
tattttttgg |
Secondary structure (Cloverleaf model) | >SRA1027420 Ser AGA g Gaaa tattttttgg G - C C - G A - T G - C T - A C - G G - C T A T C A T C C A T G A G | | | | | G G G C C G G T A G G C G | | | T T T A G G C T A G TTCCCTCTGGGAGC A - T C - G T - A G - C A - T C A T A A G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |