Sequence ID | >SRA1027436 |
Genome ID | SRR035086.125305 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 291 |
End posion on genome | 220 |
Amino Acid | Pro |
Anticodon | AGG |
Upstream region at tRNA start position |
aatatgaact |
tRNA gene sequence |
GGCTCTTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGTCCCGGGTTCAAATC |
Downstream region at tRNA end position |
atatttttta |
Secondary structure (Cloverleaf model) | >SRA1027436 Pro AGG t Caaa atatttttta G - C G - C C - G T - A C - G T + G T - A T A T G G C C C A G A G | | | | | A G T C T G C C G G G C G | | + T T G T G A T T A T AGGTC C - G T - A C - G G - C C - G T T T G A G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |