| Sequence ID | >SRA1027442 |
| Genome ID | SRR035086.125805 |
| Phylum/Class | 454 Sequencing (SRP001807) |
| Species | |
| Start position on genome | 354 |
| End posion on genome | 283 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
aatgtaacaa |
| tRNA gene sequence |
TCCTCGATAGTCTAGTGGTGAGGATCTCCGCCTGTCACGTGGAAGGCCCGGGTTCGATTC |
| Downstream region at tRNA end position |
tatttttatc |
| Secondary structure (Cloverleaf model) | >SRA1027442 Asp GTC
a Gtaa tatttttatc
T - A
C - G
C - G
T + G
C - G
G - C
A - T T T
T G G C C C A
T G A A | | | | | G
G T C T G C C G G G C
G + | | + T T
T G G A T
G A C AGGC
T - A
C - G
C - G
G + T
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |