Sequence ID | >SRA1027525 |
Genome ID | SRR035086.141314 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 397 |
End posion on genome | 326 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taacaagcaa |
tRNA gene sequence |
GCCTCTATAGCTCAGTGGCAGAGCACTGGTCTTGTAAACCAGGGGTCGAGAGTTCAATCC |
Downstream region at tRNA end position |
agttgatcat |
Secondary structure (Cloverleaf model) | >SRA1027525 Thr TGT a Aatt agttgatcat G - C C - G C - G T - A C - G T + G A - T C T T C T C T C A G A A | | | | | A T C T C G G A G A G C G | | | | T T G G A G C C A A GGGTC C - G T - A G - C G - C T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |