| Sequence ID | >SRA1027549 |
| Genome ID | SRR035086.146155 |
| Phylum/Class | 454 Sequencing (SRP001807) |
| Species | |
| Start position on genome | 195 |
| End posion on genome | 270 |
| Amino Acid | Val |
| Anticodon | AAC |
| Upstream region at tRNA start position |
aatttaacaa |
| tRNA gene sequence |
GTTTCTATGGTGTAGCGGTTATCACGTCTGCCTAACACGCAGAAGGTCTCCGGTTCGATC |
| Downstream region at tRNA end position |
tcccacgtgg |
| Secondary structure (Cloverleaf model) | >SRA1027549 Val AAC
a ATCA tcccacgtgg
G - C
T - A
T - A
T - A
C - G
T - A
A - T C T
T A G G C C A
C G A G | | | | | G
G T G T G T C C G G C
G | | | T T
T T C A C
T A G AGGTC
T - A
C - G
T - A
G - C
C - G
C C
T A
A A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |