Sequence ID | >C151104170 |
Genome ID | LN813019 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. R57-5 [LN813019] |
Start position on genome | 2934066 |
End posion on genome | 2933990 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgaggaaaa |
tRNA gene sequence |
GGCTACGTAGCTCAGCTGGTTAGAGCACATCACTCATAATGATGGGGTCCCCTGTTCAAA |
Downstream region at tRNA end position |
catcaacctc |
Secondary structure (Cloverleaf model) | >C151104170 Met CAT a ACCA catcaacctc G - C G - C C - G T - A A - T C - G G - C T A T G G G A C A C G A A | | | | | A T C T C G C C C T G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |