Sequence ID | >C151104335 |
Genome ID | LN829119 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Candidatus Filomicrobium marinum Y [LN829119] |
Start position on genome | 2738436 |
End posion on genome | 2738510 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctcatgttgt |
tRNA gene sequence |
GGGCGGTTAGCTCAGTGGTAGAGCGCCTCGTTTACACCGAGGATGTCGGGAGTTCGACCC |
Downstream region at tRNA end position |
ttcttccgat |
Secondary structure (Cloverleaf model) | >C151104335 Val TAC t ACCA ttcttccgat G - C G - C G - C C - G G - C G - C T - A C C T C T C T C A G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |