Sequence ID | >SRA1027665 |
Genome ID | SRR035086.168409 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 422 |
End posion on genome | 496 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccacccaaaa |
tRNA gene sequence |
AGGGCCGTAGCTCAATTGGTTAGAGTACCGGACTGTCGATCCGGGGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
ttttaaacgc |
Secondary structure (Cloverleaf model) | >SRA1027665 Asp GTC a GCtt ttttaaacgc A C G + T G - C G - C C - G C - G G - C T G T T G C C C A T A A A + | | | | A T C T C G G C G G G C G | | | + T T G G A G T T T A A GGGTT C - G C - G G - C G - C A - T C A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |