Sequence ID | >C153000165 |
Genome ID | CP006018 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium indicum LMG 11587 = DSM 20214 [CP006018] |
Start position on genome | 121662 |
End posion on genome | 121733 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cggtgcgact |
tRNA gene sequence |
GCGGGCGTAGTTCATTGGTAGAATGGAAGCTTCCCAAGCTTCAGAGGCGGGTCCGATTCC |
Downstream region at tRNA end position |
gtagatttca |
Secondary structure (Cloverleaf model) | >C153000165 Gly CCC t TCtc gtagatttca G - C C - G G - C G - C G - C C - G G - C T T T T G C C C A T A A + | | | | G T C T T G G C G G G C G | | | + T C G G A A T T A G AGAG G - C A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |