| Sequence ID | >SRA1027953 |
| Genome ID | SRR035086.225486 |
| Phylum/Class | 454 Sequencing (SRP001807) |
| Species | |
| Start position on genome | 123 |
| End posion on genome | 194 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
gcgtcgaatc |
| tRNA gene sequence |
GCGGATGTAGCTCAGTGGTAGAGCATCTCCTTGCCAAGGAGAAAGTCGAGAGTTCGAATC |
| Downstream region at tRNA end position |
atcagccaat |
| Secondary structure (Cloverleaf model) | >SRA1027953 Gly GCC
c Ttga atcagccaat
G - C
C - G
G - C
G - C
A - T
T - A
G - C T A
T T T C T C A
G A A + | | | | G
T C T C G G A G A G C
G | | | | T T
G G A G C
T A A AAGTC
T - A
C - G
T - A
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |