| Sequence ID | >SRA1028087 |
| Genome ID | SRR035086.256277 |
| Phylum/Class | 454 Sequencing (SRP001807) |
| Species | |
| Start position on genome | 364 |
| End posion on genome | 280 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
attgtgacaT |
| tRNA gene sequence |
GACAATGTGGCCGAGTGGTTAAGGCGTTGGACTGCTAATCCAAGTGGGCTCTGCCCGCGT |
| Downstream region at tRNA end position |
atttttattt |
| Secondary structure (Cloverleaf model) | >SRA1028087 Ser GCT
T GTaa atttttattt
G - C
A - T
C - G
A - T
A - T
T + G
G - C T A
T T A C C C A
T G A G + | | | | G
G G C C G G T G G G C
G | | | T T
T A G G C
T A G GTGGGCTCTGCCCGC
T - A
T - A
G - C
G - C
A - T
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |