Sequence ID | >SRA1028107 |
Genome ID | SRR035086.259441 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 165 |
End posion on genome | 93 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgcaatacac |
tRNA gene sequence |
GCCTCGGTAGCGCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGGCCGTGAGTTCGAGC |
Downstream region at tRNA end position |
attttaccgc |
Secondary structure (Cloverleaf model) | >SRA1028107 Met CAT c Aaaa attttaccgc G - C C - G C - G T + G C - G G - C G + T C G T C A C T C A T G A A | | | | | G A C G C G G T G A G C G | | | | T T G G C G C C A G AGGCC T - A C - G A - T G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |